Sequencing involves the following steps:

1. Digestion of genomic DNA with two four-cutter restriction enzymes,
2. ligase-mediated circularization of the DNA,
3. PCR of the transposon-genome junctions using outward-facing primers.
4. Illumina-sequencing of the combined PCR products.

The picture below schematizes the procedure (for DpnII here, but the idea is identical for NlaIII):

Protocol

1. Digestion

• 2x 2 μg of genomic DNA are digested in parallel in Non-Stick microfuge tubes (Ambion AM12450) with 50 units of DpnII (NEB #R0543L) and NlaIII (NEB #R0125L), in 50 μl for 16 hours at 37°C.

Typical digestions. Lane 1, marker, Lane 2, NlaIII digestion (2 μl: 80 ng), Lane 3 DpnII digestion (2 μl: 80 ng). The marker is GeneRuler 1kb.

2. Circularization

• The reactions are then heat inactivated at 65°C for 20 min and
• circularized in the same tube by ligation with 25 Weiss units T4 Ligase (Thermo Scientific #EL0011) for 6 hours at 22°C, in a volume of 400μl.
• DNA is precipitated overnight or longer at -20°C in 0.3 M NaOAc pH5.2, 1 ml 100% EtOH, using 5 μg linear acrylamide (Ambion AM9520) as a carrier, then centrifuged for 20 min at 16100x g, 4°C.
• Pellets are washed with 1 ml 70% EtOH, for 20 min at 16100 x g, 20°C.
• After complete removal of the supernatant, pellets are dried for 10 min at 37°C.

3.PCR

• Each circularized DNA preparation is then resuspended in water and divided into 10X 100 μl PCR reactions.
• Each 100 μl PCR reaction contains: 10 μl 10X Taq Buffer (see recipe below), 200 μM dNTPs, 1 μM primer #1, 1 μM primer #2 , 2.4 μl homemade Taq polymerase.
• PCR are performed in an MJ Research Peltier Thermal Cycler PTC-200 using the following conditions:

Block: calculated - 95°C 1 min, 35X [95°C 30 sec, 55°C 30 sec, 72°C 3 min], 72°C 10 min.

• The 2X 10 PCR reactions are pooled into one NlaIII-digested pool and one DpnII-digested pool.
• 100μl of each pool are purified using a PCR clean-up/gel extraction kit (Macherey-Nagel) according to the manufacturer protocol, with the following modifications. DNA is bound to the column for 30s at 3000x g; 30 μl of elution buffer (10 mM Tris-HCl pH8.5, 0.1% Tween) is applied to the column and incubated for 3 min, then spun for 1 min at 11000x g at 20°C. The eluate is reapplied to the column and a second elution is performed under the same conditions.
• Purified PCR products are quantified by absorbance at 260 nm.
• On a 1% agarose gel, the product runs as a smear from 250 bp to 1.2 kb, with highest density centered around 500bp. The 867 bp size band present in the NlaIII treated sample and the 465 bp size band present in the DpnII treated sample correspond to untransposed pBK257.

Three successfully PCR-amplified libraries. Left, NlaIII-digested, right, DpnII-digested. Note the band corresponding to the remaining non-transposed ADE2-MiniDs. The important part is the smear here. The marker is GeneRuler 1kb.

4. Sequencing

• Equal amounts of DpnII- and NlaIII-digested DNA are pooled and sequenced using MiSeq v3 chemistry, according to manufacturer, adding 3.4 μl of 100 μM primer #3 into well 12 of the sequencing cartridge.

Reagents

• Non-Stick microfuge tubes (Ambion AM12450)
• DpnII (NEB #R0543L)
• NlaIII (NEB #R0125L)
• T4 Ligase (Thermo Scientific #EL0011)
• linear acrylamide (Ambion AM9520)
• 10x TAQ buffer: 500 mM Tris-HCl pH9.2, 22.5 mM MgCl2, 160 mM NH4SO4, 20% DMSO, 1% Triton X-100 - stored at -20°C
• PCR clean-up/gel extraction kit (Macherey-Nagel)

Primers

1 P5_MiniDs AATGATACGGCGACCACCGAGATCTACtccgtcccgcaagttaaata

2 MiniDs_P7 CAAGCAGAAGACGGCATACGAGATacgaaaacgaacgggataaa

3 688_minidsSEQ1210 tttaccgaccgttaccgaccgttttcatcccta

(Optional – Barcoding/Indexing/multiplexing)

Barcoding your library might allow you to pool several libraries in the same run, especially if you are using a machine with a higher throuput than the MiSeq.

To barcode libraries, an 8bp index is placed within the MiniDs_P7 primer as follows:

MiniDs_P7 CAAGCAGAAGACGGCATACGAGAT_(index)_acgaaaacgaacgggataaa

The index sequences that we have been working with are derived from the D701-D712 TruseqHT indexes (link. The index sequence in the primer must be the reverse complement of that in the TruSeq document in the link).

The index are then read using a custom indexing primer

custom_index1 GGTTTTCGATTACCGTATTTATCCCGTTCGTTTTCGT

Be careful, when mixing different indexes, to make sure that, at the first cycles, the machine reads a combination of A, T, G, and C (e.g. having all indexes starting with a T could confuse the sequencer, more details here).

Please discuss the approach with your sequencing facility staff, as we have only moderate experience with pooling libraries.